Illumina HiSeq2000 adaptor and sequencing

View the large version of the figure

I've referred the following material when making the figure:

http://support.illumina.com/sequencing/sequencing_kits/pe_dna_sample_prep_kit/training.ilmn

http://www.broadinstitute.org/files/shared/illuminavids/clusterGenSlides.pdf

Just one learning note:

If insert is not long enough (i.e. shorter than the read length), R1 will have contamination from Rd2 SP (e.g. AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC) and R2 will have contamination from reverse complementary of Rd1 SP (e.g. AGATCGGAAGAGCG)

So, basically you just need to check if the shared complementary part of Rd1 and Rd2 SP (which is AGATCGGAAGAGC) occurs in the reads. If yes, simply trim it and its following part (if any).

Note: if you don't understand the "shared complementary part", please refer my previous blog on Illumina adaptor. Here is the link: http://onetipperday.blogspot.com/2013/06/illumina-hiseq2000-adaptor.html

Here is one solution of howto remove adaptor contamination:

1. save the complementary part into a fasta file, e.g. adaptor.fa

>adaptor_complementary_part

AGATCGGAAGAGC

2. run fastq-mcf to remove adaptor

fastq-mcf -o filted -x 10 -l 15 -w 4 -u adaptor.fa input.fq.gz